Protein
View in Explore- Genbank accession
- AAQ92753.1 [GenBank]
- Protein name
- tail protein Pb4
- RBP type
-
TSPTF
- Protein sequence
-
MISNNAPAKMVLNSVLTGYTLAYIQHSIYSDYDVIGRSFWLKEGSNVTRRDFTGIDTFSVTINNLKPTTTYEVQGAFYDSIIDSELLNAQIGINLSDKQTFKMKSAPRITGARCESEPVDVGVGAPIVYIDTTGEADYCTIELKDNSNANNPWVKYYVGALMPTIMFGGVPIGSYKVRISGQISLPDGVTIDSSGYYEYPNVFEVRYNFVPPAAPINIVFKAARIADGKERYDLRVQWDWNRGAGANVREFVLSYIDSAEFVRTGWTKAQKINVGAAQSATIISFPWKVEHKFKVSSIAWGPDAQDVTDSAVQTFILNESTPLDNSFVNETGIEVNYAYIKGKIKDGSTWKQTFLIDAATGAINIGLLDAEGKAPISFDPVKKIVNVDGSVITKTINAANFVMTNLTGQDNPAIYTQGKTWGDTKSGIWMGMDNVTAKPKLDIGNATQYIRYDGNILRISSEVVIGTPNGDIDIQTGIQGKQTVFIYIIGTSLPAKPTSPAYPPSGWSKTPPNRTSNTQNIYCSTGTLDPVTNQLVSGTSWSDVVQWSGTEGVDGRPGATGQRGPGMYSLAIANLTAWNDSQANSFFTSNFGSGPVKYDVLTEYKSGAPGTAFTRQWNGSAWTSPAMVLHGDMIVNGTVTASKIVANNAFLSQIGVNIIYDRAAALSSNPEGSYKMKIDLQNGYIHIR
- Physico‐chemical
properties -
protein length: 688 AA molecular weight: 74790,23460 Da isoelectric point: 5,64118 aromaticity: 0,10320 hydropathy: -0,19724
Domains
Domain architecture
AAQ92753.1
1
688 aa
STR 10–97 · STR 103–197 · STR 211–335 · STR 350–667 ·
ATT Attachment Domain
STR Structural Domain
RBD Receptor-Binding Domain
CBM Carbohydrate-Binding Module
LEC Lectin-like Domain
ENZ Enzymatic Domain
CHP Intramolecular Chaperone
LNK Linker/Spacer Domain
TAS Tail-Associated Structural
TTP Tail Tubular Protein
UNK Uncharacterized Domain
Unmapped
Proteins with similar domain architecture
Tail Spike Domain Segmentation
Segmented into three structural domains: N-terminal, central, and C-terminal.
Domain layout
AAQ92753.1
1
688 aa
| Domain | Start | End | Length (AA) | Confidence |
|---|---|---|---|---|
| N-terminal | 1 | 410 | 410 | 0,8680 |
| Central domain | 411 | 653 | 244 | 0,1450 |
| C-terminal | 654 | 688 | 34 | 0,9097 |
N-terminal
Central domain
C-terminal
View these domains on the 3D structure via the Color by → Tail spike option in the Tertiary structure section below.
Taxonomy
Coding sequence (CDS)
Genbank protein accession
AAQ92753.1
[NCBI]
Genbank nucleotide accession
AY543070
[NCBI]
CDS location
range 86484 -> 88550
strand -
strand -
CDS
ATGATTTCAAATAATGCACCAGCTAAAATGGTTCTAAATAGCGTCTTAACTGGATATACGTTGGCGTATATCCAGCATTCTATCTACTCTGATTACGACGTTATAGGTAGATCATTTTGGCTTAAAGAAGGCAGCAACGTTACTCGTAGGGATTTCACGGGTATTGATACTTTCTCTGTAACTATTAATAACTTAAAACCTACAACAACTTATGAAGTTCAGGGTGCATTTTATGATTCCATAATAGACTCTGAACTTCTTAATGCACAGATAGGAATTAATCTATCTGATAAGCAAACTTTTAAAATGAAATCAGCACCTAGAATCACTGGTGCTCGATGCGAGTCAGAACCAGTAGATGTTGGTGTTGGAGCACCAATAGTTTATATAGATACTACAGGGGAGGCCGATTATTGCACTATAGAATTAAAAGATAATTCTAATGCCAATAATCCATGGGTTAAATATTACGTTGGTGCACTAATGCCTACTATTATGTTTGGTGGTGTGCCAATTGGATCCTATAAGGTAAGAATTTCTGGTCAAATAAGCCTACCAGACGGTGTTACTATTGATTCATCAGGATACTATGAATATCCTAATGTCTTTGAAGTTAGATATAACTTTGTACCTCCTGCGGCTCCTATTAATATTGTGTTTAAAGCTGCGCGCATAGCAGACGGTAAAGAGCGTTATGATTTACGTGTGCAGTGGGACTGGAATAGGGGTGCGGGTGCTAATGTTCGTGAGTTCGTTCTATCTTATATAGATTCGGCAGAGTTTGTAAGAACTGGATGGACTAAGGCACAAAAAATCAACGTGGGGGCTGCTCAGTCGGCAACAATTATATCATTCCCGTGGAAAGTAGAGCATAAATTTAAAGTGTCATCTATTGCCTGGGGACCAGATGCTCAAGATGTTACTGATTCCGCAGTACAGACATTTATATTAAATGAGAGTACACCATTAGACAATAGTTTTGTTAATGAAACTGGTATCGAAGTAAACTATGCGTACATTAAGGGTAAAATTAAAGATGGATCTACCTGGAAACAAACTTTCTTAATTGACGCTGCAACTGGTGCTATTAATATAGGTCTTCTAGACGCAGAAGGAAAAGCACCAATATCCTTTGACCCTGTTAAAAAGATAGTTAACGTTGATGGGAGTGTAATAACTAAAACTATTAATGCTGCTAACTTTGTCATGACTAATTTAACCGGTCAAGATAACCCAGCAATTTATACACAGGGTAAAACTTGGGGCGATACAAAATCCGGTATCTGGATGGGCATGGATAATGTTACTGCTAAACCAAAATTAGATATTGGTAATGCTACACAGTATATTCGTTATGATGGTAATATACTTAGGATCTCTAGTGAGGTTGTAATTGGTACCCCAAATGGTGATATTGATATACAGACGGGTATACAAGGGAAGCAAACAGTATTTATCTATATTATAGGTACTTCATTACCTGCTAAACCAACAAGTCCTGCATACCCACCTTCTGGTTGGTCTAAAACTCCACCAAATAGAACATCTAATACTCAGAATATTTACTGTTCTACAGGTACTCTGGACCCAGTTACTAATCAATTAGTATCGGGAACTAGTTGGTCTGACGTAGTTCAATGGAGTGGTACAGAAGGTGTTGATGGCAGGCCGGGGGCTACAGGACAACGTGGTCCTGGAATGTATTCTCTTGCTATTGCTAATTTAACAGCATGGAATGACTCACAAGCTAATTCATTTTTTACATCTAATTTCGGCAGTGGTCCTGTTAAATATGACGTATTAACTGAATATAAGAGTGGTGCTCCTGGGACAGCTTTTACTAGACAGTGGAATGGTTCGGCGTGGACTAGCCCTGCAATGGTTTTACACGGAGATATGATAGTTAATGGCACGGTAACTGCTAGTAAAATTGTTGCTAACAATGCTTTCTTATCACAAATTGGTGTAAATATTATATATGATCGTGCAGCAGCACTATCCTCTAACCCAGAGGGATCCTACAAAATGAAGATAGACCTGCAAAACGGGTATATCCATATAAGGTAA
Genome Context
Tertiary structure
Structure ID
Source
Method
Resolution
Oligomeric state
Literature
| Title | Authors | Date | PMID | Source |
|---|---|---|---|---|
| Virus-induced acquisition of metabolic function. IV. Thymidylate synthetase in thymine-requiring Escherichia coli infected by T2 and T5 bacteriophages | BARNER,H.D. and COHEN,S.S. | 1959 | 13796860 | GenBank |
| Virus-induced acquisition of metabolic function. VI. Dihydrofolate reductase, a new phage-induced enzyme | Methews,C.K. and Cohen,S.S. | 1963 | — | GenBank |
| THE ENZYMOLOGY OF VIRUS-INFECTED BACTERIA. VI. PURIFICATION AND PROPERTIES OF THE DEOXYNUCLEOTIDE KINASE INDUCED BY BACTERIOPHAGE T5 | BESSMAN,M.J., HERRIOTT,S.T. and ORR,M.J. | 1965 | 14253449 | GenBank |
| The structural gene for deoxyribonucleic acid polymerase in bacteriophages T4 and T5 | De Waard,A., Paul,A.V. and Lehman,I.R. | 1965 | 5219829 | GenBank |
| The enzymology of virus-infected bacteria. VII. A new deoxyribonucleic acid polymerase induced by bacteriophage T5 | Orr,C.W., Herriott,S.T. and Bessman,M.J. | 1965 | 5846986 | GenBank |
| Functions of two genes in the first-step-transfer DNA of bacteriophage T5 | Lanni,Y. | 1969 | 4897799 | GenBank |
| Patterns of protein synthesis in Escherichia coli infected by amber mutants in the first-step-transfer DNA of T5 | McCorquodale,D.J. and Lanni,Y.T. | 1970 | 4915289 | GenBank |
| The deoxyribonuclease induced after infection of Escherichia coli by bacteriophage T5. I. Characterization of the enzyme as a 5'-exonuclease | Frenkel,G.D. and Richardson,C.C. | 1971 | 4327330 | GenBank |
| The deoxyribonuclease induced after infection of Escherichia coli by bacteriophage T5. II. Role of the enzyme in replication of the pahge deoxyribonucleic acid | Frenkel,G.D. and Richardson,C.C. | 1971 | 4934992 | GenBank |
| Pre-early proteins of bacteriophage T5: structure and function | Beckman,L.D., Hoffman,M.S. and McCorquodale,D.J. | 1971 | 5136582 | GenBank |
| Genetic and physiological studies of bacteriophage T5. 3. Patterns of deoxyribonucleic acid synthesis induced by mutants of T5 and the identification of genes influencing the appearance of phage-induced dihydrofolate reductase and deoxyribonuclease | Hendrickson,H.E. and McCorquodale,D.J. | 1972 | 4556511 | GenBank |
| Structural proteins of bacteriophage T5 | Zweig,M. and Cummings,D.J. | 1973 | 4571380 | GenBank |
| Bacteriophage-induced ribonucleotide reductase systems. T5- and T6-specific ribonucleotide reductase and thioredoxin | Eriksson,S. and Berglund,O. | 1974 | 4152788 | GenBank |
| Early events after infection of Escherichia coli by bacteriophage T5. Induction of a 5'-nucleotidase activity and excretion of free bases | Warner,H.R., Drong,R.F. and Berget,S.M. | 1975 | 163355 | GenBank |
| In vivo repair of bacteriophage t5 DNA: an assay for viral growth control | Herman,R.C. and Moyer,R.W. | 1975 | 1098275 | GenBank |
| Early events after infection of Escherichia coli by bacteriophage T5. II. Control of the bacteriophage-induced 5'-nucleotidase activity | Berget,S.M., Mozer,T.J. and Warner,H.R. | 1976 | 176472 | GenBank |
| Characterization of DNA polymerase induced by bacteriophage T5 with DNA containing single strand breaks | Fujimura,R.K. and Roop,B.C. | 1976 | 773933 | GenBank |
| Electron micrographs of nicked DNA replicated by T5 DNA polymerase | Fujimura,R.K. and Allison,D.P. | 1976 | 1270429 | GenBank |
| Identification of the gene controlling the synthesis of the major bacteriophage T5 membrane protein | Duckworth,D.H., Dunn,G.B. and McCorquodale,D.J. | 1976 | 775127 | GenBank |
| Exonuclease associated with bacteriophage T5-Induced DNA polymerase | Das,S.K. and Fujimura,R.K. | 1976 | 10451 | GenBank |
| Temperature-sensitive DNA polymerase induced by a bacteriophage T5 mutant: relationship between polymerase and exonuclease activities | Fujimura,R.K. and Roop,B.C. | 1976 | 974066 | GenBank |
| Pre-early polypeptides of bacteriophages T5 and BF23 | McCorquodale,D.J., Shaw,A.R., Shaw,P.K. and Chinnadurai,G. | 1977 | 325230 | GenBank |
| Properties of deoxynucleoside 5'-monophosphatase induced by bacteriophage T5 after infection of Escherichia coli | Mozer,T.J. and Warner,H.R. | 1977 | 21305 | GenBank |
| Isolation and characterization of a bacteriophage T5 mutant deficient in deoxynucleoside 5'-monophosphatase activity | Mozer,T.J., Thompson,R.B., Berget,S.M. and Warner,H.R. | 1977 | 335083 | GenBank |
| Mechanism of T5-induced DNA polymerase. I. Replication of short primer templates | Das,S.K. and Fujimura,R.K. | 1977 | 336621 | GenBank |
| Mechanism of T5-induced DNA polymerase. II. Characterization of the dead-end complex | Das,S.K. and Fujimura,R.K. | 1977 | 411791 | GenBank |
| Gene D5 product of bacteriophage T5: DNA-binding protein affecting DNA replication and late gene expression | McCorquodale,D.J., Gossling,J., Benzinger,R., Chesney,R., Lawhorne,L. and Moyer,R.W. | 1979 | 219226 | GenBank |
| Processiveness of DNA polymerases. A comparative study using a simple procedure | Das,S.K. and Fujimura,R.K. | 1979 | 368069 | GenBank |
| The purification and properties of a double-stranded DNA-binding protein encoded by the gene D5 of bacteriophage T5 | Rice,A.C., Ficht,T.A., Holladay,L.A. and Moyer,R.W. | 1979 | 224043 | GenBank |
| The properties of a bacteriophage T5 mutant unable to induce deoxyuridine 5'-triphosphate nucleotidohydrolase. Synthesis of uracil-containing T5 deoxyribonucleic acid | Warner,H.R., Thompson,R.B., Mozer,T.J. and Duncan,B.K. | 1979 | 381286 | GenBank |
| Mechanism of 3' to 5' exonuclease associated with phage T5-induced DNA polymerase: processiveness and template specificity | Das,S.K. and Fujimura,R.K. | 1980 | 6255449 | GenBank |
| Mechanism of primer-template-dependent conversion of dNTP leads to dNMP by T5 DNA polymerase | Das,S.K. and Fujimura,R.K. | 1980 | 6248549 | GenBank |
| Replication of linear duplex DNA in vitro with bacteriophage T5 DNA polymerase | Fujimura,R.K., Das,S.K., Allison,D.P. and Roop,B.C. | 1981 | 7280264 | GenBank |
| Second-step transfer of bacteriophage T5 DNA: purification and characterization of the T5 gene A2 protein | Snyder,C.E. Jr. and Benzinger,R.H. | 1981 | 7288924 | GenBank |
| Cloning of bacteriophage T5 DNA fragments. III. Expression in Escherichia coli mini-cells | Brunel,F., Davison,J., Ha-Thi,V. and Reeve,J. | 1981 | 6282684 | GenBank |
| Modification of RNA polymerase from Escherichia coli by pre-early gene products of bacteriophage T5 | McCorquodale,D.J., Chen,C.W., Joseph,M.K. and Woychik,R. | 1981 | 7033565 | GenBank |
| The nucleotide sequence of bacteriophage T5 RNAI | Kryukov,V.M., Shlyapnikov,M.G., Kazantsev,S.I., Kaliman,A.V., Ksenzenko,V.N. and Bayev,A.A. | 1982 | — | GenBank |
| Cloning of genes for bacteriophage T5 stable RNAs | Ksenzenko,V.N., Kamynina,T.P., Kazantsev,S.I., Shlyapnikov,M.G., Kryukov,V.M. and Bayev,A.A. | 1982 | 6285979 | GenBank |
| Interaction of a DNA-binding protein, the gene product of D5 of bacteriophage T5, with double-stranded DNA. Analysis by metrizamide gradient centrifugation | Fujimura,R.K. and Roop,B.C. | 1982 | 6294081 | GenBank |
| Interaction of a DNA-binding protein, the product of gene D5 of bacteriophage T5, with double-stranded DNA: effects on T5 DNA polymerase functions in vitro | Fujimura,R.K. and Roop,B.C. | 1983 | 6304341 | GenBank |
| Cloning and DNA sequence of the genes for two bacteriophage T5 tRNAsSer | Kryukov,V.M., Ksenzenko,V.N., Kaliman,A.V. and Bayev,A.A. | 1983 | 6552980 | GenBank |
| O antigen-dependent mutant of bacteriophage T5 | Heller,K.J. and Bryniok,D. | 1984 | 6361278 | GenBank |
| The nucleotide sequence of bacteriophage T5 glutamine transfer RNA | Shlyapnikov,M.G., Kaliman,A.V., Kazantsev,S.I., Kryukov,V.M. and Bayev,A.A. | 1984 | 6733112 | GenBank |
| Identification of the phage gene for host receptor specificity by analyzing hybrid phages of T5 and BF23 | Heller,K.J. | 1984 | 6093378 | GenBank |
| Bacteriophage T5 gene A2 protein alters the outer membrane of Escherichia coli | Snyder,C.E. Jr. | 1984 | 6389511 | GenBank |
| Physical locus of the DNA polymerase gene and genetic maps of bacteriophage T5 mutants | Fujimura,R.K., Tavtigian,S.V., Choy,T.L. and Roop,B.C. | 1985 | 2982033 | GenBank |
| Isolation and partial characterization of a bacteriophage T5 mutant unable to induce thymidylate synthetase and its use in studying the effect of uracil incorporation into DNA on early gene expression | Swart,W.J. Jr. and Warner,H.R. | 1985 | 3973984 | GenBank |
| Irreversible binding to the receptor of bacteriophages T5 and BF23 does not occur with the tip of the tail | Heller,K.J. and Schwarz,H. | 1985 | 3886629 | GenBank |
| Identification by immunobinding assay of the polypeptide coded by the DNA polymerase gene of bacteriophage T5 and its amber mutants and the direction of transcription of the gene | Schneider,S.S., Roop,B.C. and Fujimura,R.K. | 1985 | 3897573 | GenBank |
| The nucleotide sequence of bacteriophage T5 leucine tRNA | Shlyapnikov,M.G., Kazantsev,S.I., Kryukov,V.M. and Bayev,A.A. | 1985 | 3905432 | GenBank |
| DNA filter retention assay for exonuclease activities. Application to the analysis of processivity of phage T5 induced 5'-exonuclease | Joannes,M., Saucier,J.M. and Jacquemin-Sablon,A. | 1985 | 3004572 | GenBank |
| Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5 | Kaliman,A.V., Krutilina,A.I., Kryukov,V.M. and Bayev,A.A. | 1986 | 3002857 | GenBank |
| Cell-free transcription and translation of isolated restriction fragments localize bacteriophage T5 pre-early genes | Blaisdell,P.W. and Warner,H.R. | 1986 | 3951019 | GenBank |
| Nucleotide sequence of the bacteriophage T5 DNA fragment which contains the gene for tRNAAsp | Shlyapnikov,M.G., Ksenzenko,V.N., Kryukov,V.M. and Bayev,A.A. | 1986 | 3516691 | GenBank |
| Structure of two promoters and a terminator of transcription from the region of bacteriophage T5 early genes D10-D15 | Kaliman,A.V., Krutilina,A.I. and Kryukov,V.M. | 1987 | — | GenBank |
| Location of genes D16, D17, and N4 encoding tail proteins on the physical map of bacteriophage T5 | Krauel,V. and Heller,K.J. | 1987 | 2958389 | GenBank |
| [Primary structure of tRNAAsn of bacteriophage T5] | Shliapnikov,M.G., Kriukov,V.M. and Baev,A.A. | 1987 | 3649233 | GenBank |
| [Primary structure of proline tRNA of bacteriophage T5] | Shliapnikov,M.G., Kaliman,A.V., Kriukov,V.M. and Baev,A.A. | 1987 | 3649234 | GenBank |
| Nucleotide sequence of the bacteriophage T5 DNA fragment containing a distal part of tRNA gene region | Ksenzenko,V.N., Shlyapnikov,M.G., Azbarov,V.G., Garcia,O., Kryukov,V.M. and Bayev,A.A. | 1987 | 3299272 | GenBank |
| The nucleotide sequence of bacteriophage T5 DNA at the region between early and late genes | Kaliman,A.V., Kryukov,V.M. and Bayev,A.A. | 1988 | 3267228 | GenBank |
| The nucleotide sequence of the region of bacteriophage T5 early genes D10-D15 | Kaliman,A.V., Kryukov,V.M. and Bayev,A.A. | 1988 | 3057441 | GenBank |
| T5 DNA polymerase: structural--functional relationships to other DNA polymerases | Leavitt,M.C. and Ito,J. | 1989 | 2660138 | GenBank |
| Two early genes of bacteriophage T5 encode proteins containing an NTP-binding sequence motif and probably involved in DNA replication, recombination and repair | Blinov,V.M., Koonin,E.V., Gorbalenya,A.E., Kaliman,A.V. and Kryukov,V.M. | 1989 | 2547651 | GenBank |
| Properties of overexpressed phage T5 D15 exonuclease. Similarities with Escherichia coli DNA polymerase I 5'-3' exonuclease | Sayers,J.R. and Eckstein,F. | 1990 | 2211703 | GenBank |
| Amino acid sequence of the bacteriophage T5 gene A2 protein | Snyder,C.E. Jr. | 1991 | 2059212 | GenBank |
| Cloning and overexpression of the gene encoding bacteriophage T5 DNA polymerase | Chatterjee,D.K., Fujimura,R.K., Campbell,J.H. and Gerard,G.F. | 1991 | 1995424 | GenBank |
| A single-strand specific endonuclease activity copurifies with overexpressed T5 D15 exonuclease | Sayers,J.R. and Eckstein,F. | 1991 | 1651477 | GenBank |
| Nucleotide sequence of the phage T5 DNA segment containing six tRNA genes | Ksenzenko,V.N., Wilkens,K., Rueger,W. and Shlyapnikov,M.G. | 1992 | 1461745 | GenBank |
| Structure peculiarities of transfer RNAs coded by bacteriophage T5 | Shlyapnikov,M.G. and Ksenzenko,V.N. | 1994 | — | GenBank |
| Lytic conversion of Escherichia coli by bacteriophage T5: blocking of the FhuA receptor protein by a lipoprotein expressed early during infection | Decker,K., Krauel,V., Meesmann,A. and Heller,K.J. | 1994 | 8057856 | GenBank |
| Inactivation of FhuA at the cell surface of Escherichia coli K-12 by a phage T5 lipoprotein at the periplasmic face of the outer membrane | Braun,V., Killmann,H. and Herrmann,C. | 1994 | 8045901 | GenBank |
| [Features of the structure of transfer RNA coded by bacteriophage T5] | Shliapnikov,M.G. and Ksenzenko,V.N. | 1994 | 7533890 | GenBank |
| The nucleotide sequence of the bacteriophage T5 ltf gene | Kaliman,A.V., Kulshin,V.E., Shlyapnikov,M.G., Ksenzenko,V.N. and Kryukov,V.M. | 1995 | 7789514 | GenBank |
| Overproduced and purified receptor binding protein pb5 of bacteriophage T5 binds to the T5 receptor protein FhuA | Mondigler,M., Vogele,R.T. and Heller,K.J. | 1995 | 7649453 | GenBank |
| Identification of the bacteriophage T5 dUTPase by protein sequence comparisons | Kaliman,A.V. | 1996 | 8988373 | GenBank |
| Identification of the receptor-binding regions of pb5 proteins of bacteriophages T5 and BF23 | Mondigler,M., Holz,T. and Heller,K.J. | 1996 | 8623528 | GenBank |
| A helical arch allowing single-stranded DNA to thread through T5 5'-exonuclease | Ceska,T.A., Sayers,J.R., Stier,G. and Suck,D. | 6586 | 8657312 | GenBank |
| Structure-specific DNA binding by bacteriophage T5 5'-->3' exonuclease | Garforth,S.J. and Sayers,J.R. | 1997 | 9380501 | GenBank |
| Prokaryotic 5'-3' exonucleases share a common core structure with gamma-delta resolvase | Artymiuk,P.J., Ceska,T.A., Suck,D. and Sayers,J.R. | 1997 | 9336450 | GenBank |
| [Amber-suppressive tRNA from bacteriophage T5: construction of genes and determination of the effectiveness of suppression in vivo] | Pan'kova,N.V., Karamyshev,A.L., Shliapnikov,M.G., Presich,A.N. and Ksenzenko,V.N. | 1998 | 9929878 | GenBank |
| Inactivation in vitro of the Escherichia coli outer membrane protein FhuA by a phage T5-encoded lipoprotein | Pedruzzi,I., Rosenbusch,J.P. and Locher,K.P. | 1998 | 9812372 | GenBank |
| Mutagenesis of conserved lysine residues in bacteriophage T5 5'-3' exonuclease suggests separate mechanisms of endo-and exonucleolytic cleavage | Garforth,S.J., Ceska,T.A., Suck,D. and Sayers,J.R. | 1999 | 9874768 | GenBank |
| A single cleavage assay for T5 5'-->3' exonuclease: determination of the catalytic parameters forwild-type and mutant proteins | Pickering,T.J., Garforth,S.J., Thorpe,S.J., Sayers,J.R. and Grasby,J.A. | 1999 | 9889266 | GenBank |
| Variation in the steady state kinetic parameters of wild type and mutant T5 5'-3'-exonuclease with pH. Protonation of Lys-83 is critical for DNA binding | Pickering,T.J., Garforth,S., Sayers,J.R. and Grasby,J.A. | 1999 | 10364212 | GenBank |
| Unusually wide co-factor tolerance in a metalloenzyme; divalent metal ions modulate endo-exonuclease activity in T5 exonuclease | Garforth,S.J., Patel,D., Feng,M. and Sayers,J.R. | 2001 | 11433022 | GenBank |
| Characterization of a high-affinity complex between the bacterial outer membrane protein FhuA and the phage T5 protein pb5 | Plancon,L., Janmot,C., le Maire,M., Desmadril,M., Bonhivers,M., Letellier,L. and Boulanger,P. | 2002 | 12051859 | GenBank |
| Purification and characterization of the deoxynucleoside monophosphate kinase of bacteriophage T5 | Mikoulinskaia,G.V., Gubanov,S.I., Zimin,A.A., Kolesnikov,I.V., Feofanov,S.A. and Miroshnikov,A.I. | 2003 | 12597877 | GenBank |
| An intramolecular disulphide bond reduces the efficacy of a lipoprotein plasma membrane sorting signal | Robichon,C., Bonhivers,M. and Pugsley,A.P. | 2003 | 12890035 | GenBank |
| Identification, cloning, and expression of bacteriophage T5 dnk gene encoding a broad specificity deoxyribonucleoside monophosphate kinase (EC 2.7.4.13) | Mikoulinskaia,G.V., Zimin,A.A., Feofanov,S.A. and Miroshnikov,A.I. | 2004 | 14711503 | GenBank |
| Characterization of the bacteriophage T5 site-specific endonucleases F-TflV and F-TflVI | Akulenko,N.V., Shaloiko,L.A., Shlyapnikov,M.G., Krutilina,A.I. and Ksenzenko,V.N. | 2004-07 | — | GenBank |
| Identification of genes encoding bacteriophage T5 terminase and portal protein | Kaliman,A.V., Ganichkin,O.M., Vasiliev,V.D. and Ksenzenko,V.N. | 1996-01 | — | GenBank |
| Identification and characterization of novel site-specific endonucleases F-TflI, F-TflII and F-TflIV encoded by the bacteriophage T5 | Ksenzenko,V.N., Akulenko,N.V., Kaliman,A.V., Kanapin,A.A., Shestakova,N.M., Shaloiko,L.A., Krutilina,A.I., Ivashina,T.V. and Shlyapnikov,M.G. | 2004-07 | — | GenBank |
| Identification and characterization of bacteriophage T5 lysis genes | Mikoulinskaia,G.V. and Zimin,A.A. | 2015-01-19 | — | GenBank |