Protein

Experimentally validated RBP function shown
View in Explore
UniProt accession
P23207 [UniProt]
Protein name
Receptor-binding protein pb5
RBP type
TSP
Evidence DepoScope
Probability 1,00
TSP
Evidence RBPdetect
Probability 0,91
TSP
Evidence RBPdetect2
Probability 0,96
Seq2Symm
C3 confidence 0,989
C3 0,989
C1 0,306
C2 0,002
Predicted homo-oligomer symmetry (Seq2Symm, per-class probabilities; C1 = monomer, C2 = dimer, C3 = trimer).
Protein sequence
MSFFAGKLNNKSILSLRRGSGGDTNQHINPDSQTIFHSDMSHVIITETHSTGLRLDQGAGDYYWSEMPSRVTQLHNNDPNRVVLTEIEFSDGSRHMLSGMSMGVGAKAYGIINPQIMSQGGLKTQITASADLSLDVGYFNTGTSGTIPQKLRDGTGCQHMFGAFSGRRGFASSAMYLGGAALYKSAWSGSGYVVADAGTLTIPSDYVRHPGARNFGFNAIYVRGRSCNRVLYGMEGPNYTTGGAVQGASSSGALNFTYNPSNPESPKYSVGFARADPTNYAYWESMGDPNDSANGPIGIYSEHLGIYPSKITWYVTNLVYNGSGYNIDGGLFNGNDIKLSPREFIIKGVNVNNTSWKFINFIEKNFNVGNRADFRDVGCNLSKDSPSTGISGIATFGLPTTESNNAPSIKGGNVGGLHANVVSIYNFLPSASWYVSSNPPKIGNNYGDVWSENLLPLRLLGGSGSTILSGNIVFQGNGSVHVGTVGLDLNSSRNGAIVCTMEFIDDTWLSAGGIGCFNPTEMLSQGAEYGDSRFRIGGNTINKKLHQILSLPAGEYVPFFTIKGTVVNACKLQAAAYNPTPYWVSGLPGSVGQTGYYTLTYYMRNDGNNNISIWLDSSMSNIIGMKACLPNIKLIIQRLT
Physico‐chemical
properties
protein length:640 AA
molecular weight: 68725,13840 Da
isoelectric point:8,01937
aromaticity:0,10469
hydropathy:-0,22297

Domains

View on InterPro
Domain architecture
P23207
1 640 aa
RBD 1–640
ATT Attachment Domain STR Structural Domain RBD Receptor-Binding Domain CBM Carbohydrate-Binding Module LEC Lectin-like Domain ENZ Enzymatic Domain CHP Intramolecular Chaperone LNK Linker/Spacer Domain TAS Tail-Associated Structural TTP Tail Tubular Protein UNK Uncharacterized Domain Unmapped
Proteins with similar domain architecture

Tail Spike Domain Segmentation

Segmented into three structural domains: N-terminal, central, and C-terminal.

Domain layout
P23207
1 640 aa
Domain Start End Length (AA) Confidence
N-terminal 1 158 158 0,0857
Central domain 159 357 200 0,3630
C-terminal 358 640 282 0,9417
N-terminal Central domain C-terminal

View these domains on the 3D structure via the Color by → Tail spike option in the Tertiary structure section below.

Taxonomy

Phage
Escherichia phage T5 [NCBI] · taxon 2695836
Uroviricota Caudoviricetes Demerecviridae Tequintavirus Tequintavirus T5
Host
Escherichia coli [NCBI] · taxon 562
Pseudomonadota Gammaproteobacteria Enterobacterales Enterobacteriaceae Escherichia Escherichia coli

Coding sequence (CDS)

Genbank protein accession
CAA53526.1 [NCBI]
Genbank nucleotide accession
X75922 [NCBI]
CDS location
range 1 -> 62
strand -
CDS
ATGAGTTTTTTCGCTGGCAAGCTAAATAACAAATCTATACTCTCACTGCGAAGGGGTAGTGG

Genome Context

Gene Ontology

Description Category Evidence (source)
GO:0098015 virus tail Cellular Component IEA:UniProtKB-KW (UniProt)
GO:0098670 entry receptor-mediated virion attachment to host cell Biological Process IEA:UniProtKB-KW (UniProt)
GO:0046813 receptor-mediated virion attachment to host cell Biological Process IDA:UniProtKB (UniProt)
GO:0046718 symbiont entry into host cell Biological Process IEA:UniProtKB-KW (UniProt)

Tertiary structure

P23207
1 / 3
Structure ID
Source
Method
Resolution
Oligomeric state

Experimental validation

Experimentally validated

A wet-lab result is recorded for this protein, or for its sequence: a solved structure, an experimental GO annotation, a UniProt ECO:0000269 assertion, or a GenBank /experiment= qualifier.

Tier Source Assay Claim Reference
Experimentally validated GO
GO:0046813
 GO:IDA RBP receptor-mediated virion attachment to host cell ECO:0000314
Experimentally validated PDB
8B14
 structure:EM — ECO:0000006
Experimentally validated PDB
8A8C
 structure:EM — ECO:0000006
Experimentally validated UniProt
P23207
 ECO:0000269:FUNCTION:12051859 RBP Structural component of the distal part of the tail. Mediates T5 irreversible binding to its host entry receptor, the E.coli outer membrane ferrichrome transporter FhuA protein (PubMed:12051859, PubMed:22659573, PubMed:36779755). Upon binding to host FhuA, pb5 undergoes conformational changes that are probably the key to the transmission of the signal through the tail to the capsid, triggering DNA release (PubMed:24014030, PubMed:36779755, PubMed:36961893) PMID 12051859
Experimentally validated UniProt
P23207
 ECO:0000269:FUNCTION:22659573 RBP Structural component of the distal part of the tail. Mediates T5 irreversible binding to its host entry receptor, the E.coli outer membrane ferrichrome transporter FhuA protein (PubMed:12051859, PubMed:22659573, PubMed:36779755). Upon binding to host FhuA, pb5 undergoes conformational changes that are probably the key to the transmission of the signal through the tail to the capsid, triggering DNA release (PubMed:24014030, PubMed:36779755, PubMed:36961893) PMID 22659573
Experimentally validated UniProt
P23207
 ECO:0000269:FUNCTION:24014030 RBP Structural component of the distal part of the tail. Mediates T5 irreversible binding to its host entry receptor, the E.coli outer membrane ferrichrome transporter FhuA protein (PubMed:12051859, PubMed:22659573, PubMed:36779755). Upon binding to host FhuA, pb5 undergoes conformational changes that are probably the key to the transmission of the signal through the tail to the capsid, triggering DNA release (PubMed:24014030, PubMed:36779755, PubMed:36961893) PMID 24014030
Experimentally validated UniProt
P23207
 ECO:0000269:FUNCTION:36779755 RBP Structural component of the distal part of the tail. Mediates T5 irreversible binding to its host entry receptor, the E.coli outer membrane ferrichrome transporter FhuA protein (PubMed:12051859, PubMed:22659573, PubMed:36779755). Upon binding to host FhuA, pb5 undergoes conformational changes that are probably the key to the transmission of the signal through the tail to the capsid, triggering DNA release (PubMed:24014030, PubMed:36779755, PubMed:36961893) PMID 36779755
Experimentally validated UniProt
P23207
 ECO:0000269:FUNCTION:36961893 RBP Structural component of the distal part of the tail. Mediates T5 irreversible binding to its host entry receptor, the E.coli outer membrane ferrichrome transporter FhuA protein (PubMed:12051859, PubMed:22659573, PubMed:36779755). Upon binding to host FhuA, pb5 undergoes conformational changes that are probably the key to the transmission of the signal through the tail to the capsid, triggering DNA release (PubMed:24014030, PubMed:36779755, PubMed:36961893) PMID 36961893
Experimentally validated UniProt
P23207
 ECO:0000269:REGION:36779755 Interaction with host FhuA PMID 36779755
Experimentally validated UniProt
P23207
 ECO:0000269:SITE:36779755 RBP Interaction with host FhuA receptor PMID 36779755
Experimentally validated UniProt
P23207
 ECO:0000269:SUBUNIT:12051859 RBP Monomer (PubMed:12051859, PubMed:36215462, PubMed:36779755). Interacts with straight fiber protein pb4 (Probable). Interacts with the host FhuA receptor; this interaction is necessary for the entry of the viral genome into the host cell (PubMed:12051859, PubMed:36215462, PubMed:36779755) PMID 12051859
Experimentally validated UniProt
P23207
 ECO:0000269:SUBUNIT:36215462 RBP Monomer (PubMed:12051859, PubMed:36215462, PubMed:36779755). Interacts with straight fiber protein pb4 (Probable). Interacts with the host FhuA receptor; this interaction is necessary for the entry of the viral genome into the host cell (PubMed:12051859, PubMed:36215462, PubMed:36779755) PMID 36215462
Experimentally validated UniProt
P23207
 ECO:0000269:SUBUNIT:36779755 RBP Monomer (PubMed:12051859, PubMed:36215462, PubMed:36779755). Interacts with straight fiber protein pb4 (Probable). Interacts with the host FhuA receptor; this interaction is necessary for the entry of the viral genome into the host cell (PubMed:12051859, PubMed:36215462, PubMed:36779755) PMID 36779755
Experimentally validated UniProt
P23207
 protein_existence:evidence_at_protein_level 1: Evidence at protein level —
Validated by sequence identity GenBank
AAS77196.1
 experiment:unspecified receptor-binding tail protein – experimental evidence, no additional details recorded —
Validated by sequence identity GenBank
YP_006985.1
 experiment:unspecified receptor binding tail protein – experimental evidence, no additional details recorded —
Literature-linked PubMed
36779755
 literature_xref — PMID 36779755

Rows marked “Validated by sequence identity” come from a different entry carrying the same sequence — the experiment was not performed on this protein.

Literature

Title Authors Date PMID Source
— — 36779755 PubMed