UniProt accession
P23207 [UniProt]
Protein name
Receptor-binding protein pb5
RBP type
TSP
Evidence DepoScope
Probability 1,00
TSP
Evidence RBPdetect
Probability 0,91
Protein sequence
MSFFAGKLNNKSILSLRRGSGGDTNQHINPDSQTIFHSDMSHVIITETHSTGLRLDQGAGDYYWSEMPSRVTQLHNNDPNRVVLTEIEFSDGSRHMLSGMSMGVGAKAYGIINPQIMSQGGLKTQITASADLSLDVGYFNTGTSGTIPQKLRDGTGCQHMFGAFSGRRGFASSAMYLGGAALYKSAWSGSGYVVADAGTLTIPSDYVRHPGARNFGFNAIYVRGRSCNRVLYGMEGPNYTTGGAVQGASSSGALNFTYNPSNPESPKYSVGFARADPTNYAYWESMGDPNDSANGPIGIYSEHLGIYPSKITWYVTNLVYNGSGYNIDGGLFNGNDIKLSPREFIIKGVNVNNTSWKFINFIEKNFNVGNRADFRDVGCNLSKDSPSTGISGIATFGLPTTESNNAPSIKGGNVGGLHANVVSIYNFLPSASWYVSSNPPKIGNNYGDVWSENLLPLRLLGGSGSTILSGNIVFQGNGSVHVGTVGLDLNSSRNGAIVCTMEFIDDTWLSAGGIGCFNPTEMLSQGAEYGDSRFRIGGNTINKKLHQILSLPAGEYVPFFTIKGTVVNACKLQAAAYNPTPYWVSGLPGSVGQTGYYTLTYYMRNDGNNNISIWLDSSMSNIIGMKACLPNIKLIIQRLT
Physico‐chemical
properties
protein length:640 AA
molecular weight: 68725,13840 Da
isoelectric point:8,01937
aromaticity:0,10469
hydropathy:-0,22297

Domains

Domains [InterPro]

No domain annotations available.

Legend: Pfam SMART CDD TIGRFAM HAMAP SUPFAM PRINTS Gene3D PANTHER Other

Taxonomy

  Name Taxonomy ID Lineage
Phage Escherichia phage T5
[NCBI]
2695836 Viruses > Duplodnaviria > Heunggongvirae > Uroviricota > Caudoviricetes
Host No host information

Coding sequence (CDS)

Coding sequence (CDS)
Genbank protein accession
CAA53526.1 [NCBI]
Genbank nucleotide accession
X75922 [NCBI]
CDS location
range 1 -> 62
strand -
CDS
ATGAGTTTTTTCGCTGGCAAGCTAAATAACAAATCTATACTCTCACTGCGAAGGGGTAGTGG

Gene Ontology

Description Category Evidence (source)
GO:0098015 virus tail Cellular Component IEA:UniProtKB-KW (UniProt)
GO:0098670 entry receptor-mediated virion attachment to host cell Biological Process IEA:UniProtKB-KW (UniProt)
GO:0046813 receptor-mediated virion attachment to host cell Biological Process IDA:UniProtKB (UniProt)
GO:0046718 symbiont entry into host cell Biological Process IEA:UniProtKB-KW (UniProt)

Tertiary structure

1 / 3
PDB ID
Source
Method
Resolution
Oligomeric State

Literature

Title Authors Date PMID Source
Insights into bacteriophage T5 structure from analysis of its morphogenesis genes and protein components. Zivanovic Y, Confalonieri F, Ponchon L, Lurz R, Chami M, Flayhan A, Renouard M, Huet A, Decottignies P, Davidson AR, Breyton C, Boulanger P 2014-01 24198424 PubMed
Assessing the conformational changes of pb5, the receptor-binding protein of phage T5, upon binding to its Escherichia coli receptor FhuA. Breyton C, Flayhan A, Gabel F, Lethier M, Durand G, Boulanger P, Chami M, Ebel C 2013-10-18 24014030 PubMed
Structural basis for host recognition and superinfection exclusion by bacteriophage T5. van den Berg B, Silale A, Baslé A, Brandner AF, Mader SL, Khalid S 2022-10-18 36215462 PubMed
Characterization of a high-affinity complex between the bacterial outer membrane protein FhuA and the phage T5 protein pb5. Plançon L, Janmot C, le Maire M, Desmadril M, Bonhivers M, Letellier L, Boulanger P 2002-04-26 12051859 PubMed
Cloning, sequencing, and recombinational analysis with bacteriophage BF23 of the bacteriophage T5 oad gene encoding the receptor-binding protein. Krauel V, Heller KJ 1991-02 1825083 PubMed
New insights into pb5, the receptor binding protein of bacteriophage T5, and its interaction with its Escherichia coli receptor FhuA. Flayhan A, Wien F, Paternostre M, Boulanger P, Breyton C 2012-09 22659573 PubMed
Complete genome sequence of bacteriophage T5. Wang J, Jiang Y, Vincent M, Sun Y, Yu H, Wang J, Bao Q, Kong H, Hu S 2005-02-05 15661140 PubMed
Lytic conversion of Escherichia coli by bacteriophage T5: blocking of the FhuA receptor protein by a lipoprotein expressed early during infection. Decker K, Krauel V, Meesmann A, Heller KJ 1994-04 8057856 PubMed
Deciphering Bacteriophage T5 Host Recognition Mechanism and Infection Trigger. Degroux S, Effantin G, Linares R, Schoehn G, Breyton C 2023-03-30 36779755 PubMed
Structural basis of bacteriophage T5 infection trigger and E. coli cell wall perforation. Linares R, Arnaud CA, Effantin G, Darnault C, Epalle NH, Boeri Erba E, Schoehn G, Breyton C 2023-03-24 36961893 PubMed
Deciphering Bacteriophage T5 Host Recognition Mechanism and Infection Trigger Séraphine Degroux, Grégory Effantin, Romain Linares, Guy Schoehn, Cécile Breyton 2023-03-30 10.1128/jvi.01584-22 DOI
Insights into Bacteriophage T5 Structure from Analysis of Its Morphogenesis Genes and Protein Components Yvan Zivanovic, Fabrice Confalonieri, Luc Ponchon, Rudi Lurz, Mohamed Chami, Ali Flayhan, Madalena Renouard, Alexis Huet, Paulette Decottignies, Alan R. Davidson, Cécile Breyton, Pascale Boulanger 2014-01-15 10.1128/jvi.02262-13 DOI
Structural basis of bacteriophage T5 infection trigger and <i>E. coli</i> cell wall perforation Romain Linares, Charles-Adrien Arnaud, Grégory Effantin, Claudine Darnault, Nathan Hugo Epalle, Elisabetta Boeri Erba, Guy Schoehn, Cécile Breyton 2023-03-24 10.1126/sciadv.ade9674 DOI
Characterization of a High-affinity Complex Between the Bacterial Outer Membrane Protein FhuA and the Phage T5 Protein pb5 L Plançon, C Janmot, M le Maire, M Desmadril, M Bonhivers, L Letellier, P Boulanger 2002-04 10.1016/s0022-2836(02)00089-x DOI
Lytic conversion of <i>Escherichia coli</i> by bacteriophage T5: blocking of the FhuA receptor protein by a lipoprotein expressed early during infection Katja Decker, Verena Krauel, Anke Meesmann, Knut J. Heller 1994-04 10.1111/j.1365-2958.1994.tb01020.x DOI
Structural basis for host recognition and superinfection exclusion by bacteriophage T5 Bert van den Berg, Augustinas Silale, Arnaud Baslé, Astrid F. Brandner, Sophie L. Mader, Syma Khalid 2022-10-10 10.1073/pnas.2211672119 DOI
Complete genome sequence of bacteriophage T5 Jianbin Wang, Yan Jiang, Myriam Vincent, Yongqiao Sun, Hong Yu, Jing Wang, Qiyu Bao, Huimin Kong, Songnian Hu 2005-02 10.1016/j.virol.2004.10.049 DOI
Assessing the Conformational Changes of pb5, the Receptor-binding Protein of Phage T5, upon Binding to Its Escherichia coli Receptor FhuA Cécile Breyton, Ali Flayhan, Frank Gabel, Mathilde Lethier, Grégory Durand, Pascale Boulanger, Mohamed Chami, Christine Ebel 2013-10 10.1074/jbc.m113.501536 DOI
Cloning, sequencing, and recombinational analysis with bacteriophage BF23 of the bacteriophage T5 oad gene encoding the receptor-binding protein V Krauel, K J Heller 1991-02 10.1128/jb.173.3.1287-1297.1991 DOI
New insights into pb5, the receptor binding protein of bacteriophage T5, and its interaction with its Escherichia coli receptor FhuA Ali Flayhan, Frank Wien, Maïté Paternostre, Pascale Boulanger, Cécile Breyton 2012-09 10.1016/j.biochi.2012.05.021 DOI